Des preuves biochimiques officielles confirment que Moderna a créé le Covid-19

Le très informé Michel Duchaine vient de publier une synthèse vertigineuse qui démontre l’arnaque criminelle du Covid-19. En effet, vous allez découvrir que des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19. Accrochez-vous, l’inversion du réel va bientôt prendre fin. by Mary Josephson 9 mars 2022

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

lire la suite: https://www.apar.tv/alt-news/des-preuves-biochimiques-officielles-confirment-que-moderna-a-cree-le-covid-19/

Votre commentaire

Choisissez une méthode de connexion pour poster votre commentaire:

Logo WordPress.com

Vous commentez à l’aide de votre compte WordPress.com. Déconnexion /  Changer )

Image Twitter

Vous commentez à l’aide de votre compte Twitter. Déconnexion /  Changer )

Photo Facebook

Vous commentez à l’aide de votre compte Facebook. Déconnexion /  Changer )

Connexion à %s

Ce site utilise Akismet pour réduire les indésirables. En savoir plus sur la façon dont les données de vos commentaires sont traitées.