Le plus gros mensonge de l’histoire du monde : la base de données est défectueuse. Il n’y a jamais eu de pandémie. – Prof Michel Chossudovsky

Les mandats Covid, y compris le vaccin, ne sont pas valides Les « cas confirmés de Covid-19 » par PCR n’ont aucun sens. Le projet de test d’antigènes et à domicile de plusieurs milliards de dollars est faux.

By Prof Michel Chossudovsky – Global Research, March 26, 2022

introduction

Déstabiliser la structure sociale, politique et économique de 190 pays souverains ne peut constituer une « solution » pour lutter contre le virus. Mais c’était la « solution » imposée qui a été mise en œuvre en plusieurs étapes dès le début de la crise corona en janvier 2020. C’est la destruction de la vie des gens. C’est la déstabilisation de la société civile. La fausse science soutenait ce programme dévastateur.

Les mensonges ont été soutenus par une campagne massive de désinformation dans les médias. 24/7, « Alertes Covid » incessantes et répétitives au cours des deux dernières années. Le confinement historique du 11 mars 2020 a déclenché un chaos économique et social dans le monde entier. C’était un acte de « guerre économique » : une guerre contre l’humanité. Ce programme diabolique a sapé la souveraineté des États-nations. Il a contribué à une vague de faillites. Il a appauvri les gens dans le monde entier.

Cela a conduit à une spirale de la dette mondiale libellée en dollars. Les puissantes structures du capitalisme mondial, le Big Money couplé à son intelligence et son appareil militaire en sont la force motrice. En utilisant des technologies numériques et de communication avancées, le verrouillage et la «fermeture» de l’économie mondiale sont sans précédent dans l’histoire du monde. Le rôle central du test de réaction en chaîne par polymérase de transcription inverse (RT-PCR) « Le PCR est un processus.

Il ne vous dit pas que vous êtes malade ». Le Dr Kary Mullis, lauréat du prix Nobel et inventeur de la RT-PCR, est décédé en août 2019. Cette utilisation abusive de la technique RT-PCR est appliquée comme une stratégie implacable et intentionnelle par certains gouvernements pour justifier des mesures excessives telles que la violation d’un grand nombre de droits constitutionnels, … sous prétexte d’une pandémie basée sur un certain nombre de RT- positifs Des tests PCR, et non sur un nombre réel de patients. .

Dr. Pascal Sacré, médecin belge spécialisé en soins intensifs et analyste renommé en santé publique. L’intégralité de la base de données des « cas confirmés de Covid-19 » est invalide. Dès le début, les médias et les gouvernements ont négligé et ignoré les défauts et les faussetés concernant le test RT-PCR comme moyen de détecter la propagation du virus et d’identifier le SRAS-CoV-2. La désinformation médiatique a prévalu pendant plus de deux ans malgré le fait que l’OMS et le CDC (avec les sous-entendus habituels) aient confirmé ce que l’on savait depuis le tout début en janvier 2020, à savoir que le test RT-PCR utilisé pour justifier chaque mandat politique comprenant le confinement, la distanciation sociale, le masque, le confinement de la main-d’œuvre, la fermeture de l’activité économique, etc. était erroné et invalide.

L’OMS a publié son Mea Culpa il y a plus d’un an, le 20 janvier 2021. Quelques mois plus tard, les Centers for Disease Control and Prevention (CDC) (21 juillet 2021) appelaient au retrait du test PCR comme méthode valide. pour détecter et identifier le SRAS-CoV-2. Depuis le 31 décembre 2021, le test PCR n’est plus considéré comme valide par le CDC aux États-Unis. Le CDC a maintenant fermement reconnu que le test PCR ne différencie pas efficacement le Covid-19 de la grippe saisonnière. Un PCR positif n’implique pas un « cas confirmé Covid-19 ». Il pourrait s’agir de la grippe ou d’un rhume corona. Le CDC a appelé à son retrait à compter du 31 décembre 2021.

Cliquez sur cet URL pour voir la vidéo: https://stu-dio.tv/emissions/38049

Cliquez sur cet URL pour LIRE LA SUITE (anglais): https://www.globalresearch.ca/biggest-lie-in-world-history-the-data-base-is-flawed-there-never-was-a-pandemic-the-covid-mandates-including-the-vaccine-are-invalid/5772008

Geopolitics & Empire interviews Dmitry Orlov on Russian military operation in Ukraine

In Gaza

Dmitry is an astute commentator, well worth listening to his take on Russia’s military operation in the Ukraine.

« In terms of the legal basis for the Russian incursion—I wouldn’t call it an invasion; invasion is when you move in to stay, invasion leads to occupation. This is not going to lead to an occupation, so why not call it what it is, which is a military incursion & a disciplinary function—but in terms of the legal basis of it, it’s bullet proof.

Putin is a lawyer, he doesn’t do anything illegal, ever. He makes sure that all the Is are dotted & Ts are crossed, in terms of the legal basis for whatever he does. Everything he does is defensible in court.

…the collective West basically reneged on all the treaties they’ve signed, all the international agreements that they’ve entered into. When they say that Russia is doing something wrong…

Voir l’article original 137 mots de plus

Russian Military expert Andrei Martyanov on Russia’s denazification & demilitarization operation in the Ukraine

In Gaza

On March 15, I spoke with author and Russian military expert, Andrei Martyanov. His commentary and analysis are based on a deep understanding of Russian military and geopolitical issues.

Among many important things discussed were:

-that Ukraine has used prohibited weaspons against the people of the Donbass, repeatedly, including White Phosphorous

-Ukraine’s use of Ukrainian civilians as human shields, a war crime, preventing them from leaving areas of conflict (much as terrorists did Syrian civilians)

-why Russia is conducting the denazification operation

-that the hatred of Russians and calls for their murder amongst Ukrainian nationalists is not a new thing, but decades old

-that there will be a Ukrainian war crimes tribunal to hold accountable the criminals who have perpetrated untold and horrific war crimes

-Ukraine’s biological weapons

-the blatant propaganda and lies in the media war against Russia, much like the manifold lies we saw around Syria

Please do…

Voir l’article original 159 mots de plus

International Criminal Lawyer on « The Legality of War »

In Gaza

Very apt & timely article by international criminal lawyer, Christopher Black.

Excerpts:

« In my opinion Russia acted in accordance with international law under Article 51 of the UN Charter for the following reasons;

First, the Kiev regime was mounting a major offensive with NATO’s help against the Donbass Republics with the intent of destroying them. Intensive shelling had already begun days before Russia acted, the shelling of civilian buildings and infrastructure, which resulted in scores of thousands of civilians fleeing into Russia. During that period the Kiev regime also attempted to assassinate a leader of the Republics with a car bomb. Russia had no choice but to protect the Donbass peoples and since the Security Council could do nothing, and the EU and NATO were supporting the Kiev offensive against the Donbass, Russia was the only nation that could act.

The request for military assistance from the Donbass Republics also…

Voir l’article original 717 mots de plus

LUNA films – Luke Daily & Nathan Fagan-Guimond – Irlande

LUNA: Un collectif d’artistes unis pour créer des œuvres communes qui ont un impact sur la société en général et en temps réel! C’est comme ouvrir toutes les fenêtres et les portes lorsqu’il y a grand vent, c’est avoir peur et le faire quand même! Leur vision est celle de leur génération nourrie par une culture bien fournie par celles d’artistes indépendants qui les ont précédé!

Luna raconte des histoires saisissantes, ancrées dans le réalisme, avec un flair visuel et un style qui s’adressent au public contemporain.

Luna tell arresting stories, grounded in realism, with a visual flair and style that speaks to contemporary audiences.

Director: Luna/ Client: So Beer / The Naked Collective/ Agency: Behaviour

https://player.vimeo.com/video/507744941?h=bf1fb6fba4&dnt=1&app_id=122963

En Irlande il est de coutume pour les hommes de faire abstinence d’alcool pour un mois, le mois de Novevembre, comme abstinence, et une bière sans alcool à savoir zéro est une idée assez cool par rapport à la bière .o5 pourcent.

In the aftermath of a violent assault, twenty-something Danny (Peter Newington) struggles to accept the full extent of his injuries. Moving through the house-parties, nightclubs and bars of today’s Dublin, ‘Flicker’ explores the subtle pressures of contemporary Irish masculinity. It’s a raw, visceral and intimate exploration of contemporary Irish youth culture, masculinity and trauma.

The film features: Sean Doyle, Caoimhe Coburn Gray, Megan Bea-Tiernan, Tony Doyle and Robbie Dunne.
Directed by Luke Daly and Nathan Fagan-Guimond.
Produced by Aaron McEnaney, for Bold Puppy.
Winner:
Grand Prix Best Irish Short Prize – Cork International Film Festival – 2020 (Oscar-qualifying)
Runner-up (2nd Prize) – Emerging Director Awards Ireland – March 2020
Official Selection (to date):
Virgin Media Dublin International Film Festival – March 2020 (Oscar-qualifying)
Odense International Film Festival – 2020 (Oscar-qualifying)
Tirana International Film Festival – 2020 (Oscar-qualifying)
Aesthetica Short Film Festival – 2020 (Bafta-qualifying)
Alcine Film Festival – 2020 (Oscar-qualifying)

BOLD PUPPY

Bold Puppy is an Irish production company based in Dublin. We bring bold ideas to life. We produce commercials, music videos, films and documentaries. Our company is made up of an eclectic and innovative team of directors, producers and storytellers. Based in Dublin, we offer a full range of production and post-production services.

https://player.vimeo.com/video/340242988?h=dfe8ae616a&dnt=1&app_id=122963

A selection of some of our favourite projects from the last 12 months. Enjoy!
Website: boldpuppy.com
Contact Us: info@boldpuppy.com

Just Eat EP 2016 from Bold Puppy on Vimeo.

FloGas Gloves Off – Michael Conlan from Bold Puppy on Vimeo.

We teamed up with Flogas Ireland and Modo Creative to produce an interesting piece of insight into the mind and world of Michael Conlan, Michael Conlan one of our many inspirational Olympic hopefuls.
Brand: Flogas
Agency: Mediaworks
Creative and Production: Modo Creative and Bold Puppy

Director: Luke Daly
Producer: Aaron Chalkie
Assistant Director: Gillian Murphy
D.O.P: Kevin Minogue
2nd Camera Operator: Tess Masero Brioso
Editor: James Murphy
Sound Recordist: Simon Murphy
Sound Design: Simon Murphy
Camera Assist: Andrew Moore

Luke Daly and Nathan Fagan-Guimond – aka Luna – are award-winning, IFTA-nominated directors. Working across multiple styles and formats, their work is grounded in a passion for visually-arresting and immersive storytelling.

Their 2020 short drama, Flicker, won the prestigious Gran Prix Award at the Cork International Film Festival, automatically placing it on the longlist for the Oscars. It was subsequently nominated for Best Short Film at the 2021 Irish Film & Television Awards. Their 2018 social issue short documentary, Through the Cracks, was released directly online and has been viewed over 100,000+ times. It was mentioned in nearly every major Irish newspaper and segments were featured on RTE Primetime and Virgin Media News.

They have directed content for: An Post, Liberty Insurance, Jagermeister, AIG, Littlewoods, and Universal Music Ireland. Over the years, they’ve directed music videos for: Walking on Cars, Kitt Phillipa, JyellowL, Gavin James and Fangclub. 

Luna’s work has featured in: The Irish Times, the Irish Independent, Hot Press, Clash Magazine, The Skinny, and many, many more publications. Their films have screened at film festivals all over the world.

Gran Prix Irish Short – Cork International Film Festival – 2020 (Academy Award®-Qualifying Category)

Best Short Film – 2nd Place – Emerging Director Awards 2020

Best Short Documentary – IFI Stranger than Fiction Festival 2015

Best Irish Short Film, Runner Up, Cork Film Festival – 2016

Best Short Documentary  – Guth Gafa Documentary Festival – 2017

Best Short Documentary – Scottish Mental Health & the Arts Festival – 2017

Best Short Documentary – Barcelona International Short Film Festival – 2017

Nominated – Best Short Film – Irish Film & Television Awards (IFTA) 2021

Nominated – Best Irish Short Film / Commercial – Kinsale Shark Awards 2018

Nominated – Best Irish Music Video – Kinsale Shark Awards 2019

Nominated – Best Low Budget Irish Music Video – Kinsale Shark Awards 2021

Nominated – Best Production Design / Music Video – Kinsale Shark Awards 2021

Nominated – Best Editing / Music Video – Kinsale Shark Awards 2021

Nominated – Best Cinematography / Music Video – Kinsale Shark Awards 2021

LA VIE EST UN JEU COMPARÉE À L’AMOUR – poésie spokenword – Daniel Guimond

POÉSIE / DanleMiel, 13 Morse 2022

Purple GIF - Find & Share on GIPHY

LA VIE N’EST QU’UN JEU

COMPARÉE À L’AMOUR

« Au coin du boulevard Nulle-Part!

La vis de mes vices se resserre

Tel un étau en grain de peau

Au pire la mort c’est vite vécu

Au coin du boulevard Nulle-Part!

Au coin du boulevard Nulle-Part!

Ça prend toujours une ecchymose

Comme les lumières d’un ciel

Qui éclaire une ampoule à la fois

Après-demain nous saigne à blanc

Je marcherais bien le long de la plage

Entre les cordons de palmiers

Que quelque chose enfin me réchauffe

Dzzzzt!… FIN DE LA PUBLICITÉ

Ok! Basta, retour d’écran : la guerre

Au coin du boulevard Nulle-Part!

La vis de mes vices se resserre

Tel un étau en grain de peau

Combien vous voulez gager sur

Les estimées des retombées

En amputations de cerveau

(Pas pu m’en empecher…)

L’heure est venu de signer tes péchés

À genoux ça ferait l’effet pare-balle

Dans ce combat invisible

De la guerre à ton ADN

Subventionné par James Blonde

Qu’on va soit t’injecter dans le cerveau

Ou dissimuler sous forme de blé

Dans tes nano-céréales préférées

Mais les gentils vont se pratiquer

Sur tes parents et leurs petits-enfants

En l’occurrence les tiens de morveux

Commence à lire les ingrédients

C’est une guerre de l’esprit réactée

Et l’objectif principal dépasse la fusée Russe

Déconnecte-toi pas de l’ntérieur

Même quand les fils vont se toucher

Ça prend un gros court-circuit le coeur

Si et… Quand les dés vont péricliter

Et le marionettiste pris au piège

Il se donnera des cours pour la panique

Au pire la mort c’est vite vécu

Au coin du boulevard Nulle-Part!

Au coin du boulevard Nulle-Part!

Tu te réveilles aussitôt dans le corps

D’un petit morveux avec des parents

Sur le crack dans une roulotte

Dans le fond d’une cour

Dans Hochelaga sur la galoche

Avec des seringues qui traînent par terre

Au pire la mort c’est vite vécu

Au coin du boulevard Nulle-Part!

Au coin du boulevard Nulle-Part! »

– danleMiel – 13 Morse 2022

Lire la suite de « LA VIE EST UN JEU COMPARÉE À L’AMOUR – poésie spokenword – Daniel Guimond »

Des preuves biochimiques officielles confirment que Moderna a créé le Covid-19

Le très informé Michel Duchaine vient de publier une synthèse vertigineuse qui démontre l’arnaque criminelle du Covid-19. En effet, vous allez découvrir que des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19. Accrochez-vous, l’inversion du réel va bientôt prendre fin. by Mary Josephson 9 mars 2022

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

lire la suite: https://www.apar.tv/alt-news/des-preuves-biochimiques-officielles-confirment-que-moderna-a-cree-le-covid-19/

1050 cas de maladies autoimmunes

Si on observe les pires effets secondaires au 21 février 2021, donc juste 2 mois après : 1223 décès, 11 361 personnes toujours pas guéries, 9400 cas « inconnus ».

Le détail des maladies:

1050 cas de maladies autoimmunes

501 cas de convulsions, encéphalopathies

275 accidents cérébrovasculaires

151 thromboses et embolies (pulmonaires, etc)

137 détresses respiratoires…

75 cas sérieux pour femmes enceintes vaccinées: 25 fausses couches, mort fœtale. 17 cas de fièvre, éruption cutanée, allergie, urticaire bébés par exposition au lait de la mère vaccinée (dont 3 sévères).

Il y a plusieurs versions précédentes déjà sorties en novembre 2021. Ici c’est un doc. On a plus de 150 documents à analyser. 

Source : https://phmpt.org/pfizers-documents/

Document PDF au cas où il disparaisse : https://phmpt.org/wp-content/uploads/2021/11/5.3.6-postmarketing-experience.pdf « 

Traduction de la page 30 : ANNEXE 1. LISTE DES EFFETS INDÉSIRABLES D’INTÉRÊT PARTICULIER

Syndrome de délétion 1p36 ; Acidurie 2-hydroxyglutarique;Augmentation de la 5’nucléotidase;Névrite acoustique;Déficit acquis en inhibiteur du C1;Epidermolyse bulleuse acquise;Aphasie épileptique acquise;Lupus érythémateux cutané aigu ;Encéphalomyélite aiguë disséminée;Encéphalite aiguë avec crises partielles réfractaires et répétitives;Dermatose neutrophilique fébrile aiguë;Myélite flasque aiguë;Leucoencéphalite aiguë hémorragique;Œdème aigu hémorragique du nourrisson ;Lésion rénale aiguë;Rétinopathie maculaire externe aiguë;Neuropathie axonale motrice aiguë;Neuropathie axonale motrice-sensorielle aiguë;Infarctus du myocarde aigu;Syndrome de détresse respiratoire aiguë;Insuffisance respiratoire aiguë;Maladie d’Addison ;Thrombose au site d’administration;Vascularite au site d’administration;Thrombose surrénalienne;Effet indésirable après vaccination;Ageusie;Agranulocytose;Embolie aérienne;Alanine aminotransférase anormale;Alanine aminotransférase augmentée ;Crise alcoolique ; Mycose broncho-pulmonaire allergique ; Œdème allergique ; Hépatite allo-immune ; Alopécie areata ; Maladie d’Alpers ; Protéinose alvéolaire ; Ammoniac anormal ; Ammoniac augmenté ; Infection de la cavité amniotique ; Amygdalohippocampectomie ;Arthropathie amyloïde ; Amyloïdose ; Amyloïdose sénile ; Réaction anaphylactique ; Choc anaphylactique ; Réaction transfusionnelle anaphylactique ; Réaction anaphylactoïde ; Choc anaphylactoïde ; Syndrome anaphylactoïde de la grossesse ; Angioedème ;

Guerre, conflit et ennemis de la vérité

Michael Brenner — Consortium News – URL/ SOURCE: https://fr.sott.net/article/39555-Guerre-conflit-et-ennemis-de-la-verite

La frénésie engendrée par le conflit ukrainien renforce une mentalité de troupeau qui nécessite une réflexioncritique.

homme marchant Z

La perception exacte, le langage précis et l’objectivité sont les premières victimes des guerres et des conflits. Et pour cause. L’émotion éclipse la raison. Le prisme « nous/ils » réfracte et déforme nos pensées. L’individu est emporté par l’humeur collective. La frénésie gronde juste sous la surface.

Les expériences de guerre et de conflit ne sont cependant pas uniformes. Elles varient. Quel sang est versé, en quelle quantité ? Sommes-nous les protagonistes directs ou simplement les partisans empathiques de certains combattants ? Dans quelle mesure et pourquoi nous identifions-nous à un camp ? À quel point haïssons-nous l’autre camp ? Notre moi collectif est-il vulnérable ou confiant ? Quel est le niveau d’anxiété préexistant ?

Par conséquent, chaque situation est particulière. La réponse subjective d’un pays et son comportement peuvent donc être très révélateurs.

Malheureusement, l’observation est floue et sélective. Nous sommes de piètres témoins de nous-mêmes. Parfois, nous n’obtenons jamais le recul nécessaire pour rendre compte clairement de ce qui s’est passé, de ce que nous avons ressenti et de ce que nous avons fait. Curieusement, plus l’expérience est singulière, moins on est enclin et capable d’y réfléchir.

C’est le cas dans l’affaire actuelle de l’Ukraine. Cette particularité est en soi remarquable. Car cela n’est pas dû à l’indifférence, bien au contraire. Washington est le producteur et le metteur en scène en puissance de ce drame, ainsi que la co-star.

Le trait qui réclame notre attention critique est la frénésie que le conflit ukrainien a engendrée. Et ce, malgré l’absence de présence militaire américaine, l’absence d’intérêt national évident de premier ordre en jeu et l’éclatement du conflit à un moment où l’on aurait pu penser que l’appétit du pays pour ce genre de choses était rassasié par deux décennies de guerres sans fin et ratées dans presque toutes les régions du monde.

Ma principale préoccupation ici n’est pas de répondre à la question du « pourquoi ». J’ai essayé d’y répondre dans de précédents commentaires ici et ici. L’objectif est plutôt de mettre en évidence les caractéristiques de la personnalité nationale collective des États-Unis qui sont mises en évidence par notre réaction aux événements.

Hypocrisie

L’air en est chargé. La réaction émotionnelle excessive aux événements, concentrée à DC, se répand dans tout le pays – d’un océan à l’autre. Comme d’habitude, ce sont les médias et les politiciens qui prennent les devants et donnent le ton.

Lire la suite de « Guerre, conflit et ennemis de la vérité »

« L’Ukraine est le laboratoire du mondialisme » : entretien avec Lucien Cerise

Arthur Sapaudia pour E&R : Cher Lucien, vous avez écrit en 2017 l’ouvrage Retour sur Maïdan, La guerre hybride de l’OTAN, qui est plus que jamais d’actualité pour comprendre ce qui se passe en Ukraine. Quelle est votre analyse de la situation actuelle ?

Source de l’article : E&R

Des militaires ukrainiens dans une tranchée

Lucien Cerise : En Ukraine, les ennuis ont commencé en 2013, avec le lancement de la deuxième révolution colorée dans ce pays, nommée dans les médias « EuroMaïdan », formé à partir du surnom « Maïdan » de la place centrale de Kiev. Le but de cette insurrection était de faire tomber le président de la république en exercice, accusé d’être pro-russe, puis de purger l’État, l’administration et les médias de tout ce qui restait de fonctionnaires, d’intellectuels ou de journalistes favorables à la Russie.

Ceci dans la perspective de faire adhérer l’Ukraine à l’Union européenne, ce que Moscou peut supporter, et à l’OTAN, ce qui représente en revanche un danger mortel pour l’intégrité de la Russie. Sur le site de l’OTAN, la chronologie de toutes les étapes de l’intégration de l’Ukraine dans l’OTAN est récapitulée. Un extrait :

« En septembre 2020, le président ukrainien, Volodymyr Zelensky, a approuvé la nouvelle stratégie de sécurité nationale de l’Ukraine, qui prévoit le développement du Partenariat spécifique OTAN-Ukraine en vue d’une adhésion du pays à l’Organisation. » [1]

À noter, le site de l’OTAN est en quatre langues : l’anglais et le français – les deux langues diplomatiques – le russe, pour s’adresser à l’ennemi et, on se demande bien pourquoi, l’ukrainien ! Deux régions ukrainiennes ont désapprouvé en 2014 la révolution EuroMaïdan et l’avenir euro-atlantiste qu’elle promettait au pays : la Crimée, qui a rejoint la Russie, et le Donbass, que la Russie n’a pas accepté d’intégrer, ce qui a lancé une guerre civile entre l’État central de Kiev et cette région rebelle, devenue une sorte de nouvelle Vendée slave.

L’intervention militaire russe de 2022 a donc pour finalité, non pas de lancer une guerre, mais de mettre fin avec huit ans de retard à la guerre lancée par le régime de Kiev contre le Donbass en 2014. Le retour à la paix et à la vie normale en Ukraine sont cependant inacceptables pour Kiev et ses soutiens internationaux, car cela signifierait revenir à des relations pacifiques avec la Russie. Pour ma part, je savais dès 2014 que cette région du monde allait devenir l’épicentre d’une possible troisième guerre mondiale. Le complexe militaro-industriel anglo-américain a absolument besoin d’entretenir un ennemi pour justifier son existence, ce que reconnaissait George F. Kennan, l’un des théoriciens de l’encerclement offensif de la Russie, dans sa préface à un ouvrage justement intitulé La pathologie du pouvoir :

« Si l’Union soviétique devait sombrer demain sous les eaux de l’océan, l’establishment militaro-industriel américain aurait à continuer, pratiquement inchangé, jusqu’à ce qu’un autre adversaire puisse être inventé. Toute autre situation serait un choc inacceptable pour l’économie américaine. » [2]

Lire la suite de « « L’Ukraine est le laboratoire du mondialisme » : entretien avec Lucien Cerise »

IMRE LODBROG – Gilet pare-balle et poésie – Chansons récentes

JOHNNY EN RÊVE

TU ME VOIS TU ME REGARDES MAIS TU ME FLASHES PLUS
TOUT JUSTE SI TU PRÊTES GARDE À MON PARDESSUS
AH C’EST DUR DE SE REVOIR M’A DIT JOHNNY EN RÊVE
AVANT DE S’ÉVAPORER DANS LA NUIT DE SAINT-TROPEZ

ALORS J’AI MIS MON PARDESSUS MES BOTTES ET MON CHAPEAU
ET J’AI MARCHÉ DANS LES RUES SOUS LE GRIS CHAPITEAU
J’AI ESPÉRÉ LE REVOIR MAIS COMME DANS UN RÊVE
C’EST TOI QUI M’EST APPARU MON VIEIL AMI DISPARU

DIRE QUE JE TE CROYAIS MORT ET RAYÉ DU PAYSAGE
COMME ON JETTE PAR DESSUS BORD SON EXCÉDENT DE BAGAGES
C’ÉTAIT BON DE TE REVOIR AILLEURS QU’EN RÊVE
DE POUVOIR RAFISTOLER LE TISSU DU PASSÉ

ET PUIS J’AI SUIVI MA DÉROUTE JUSQU’AU PÉRIPHÉRIQUE
ET DE LÀ J’AI PRIS LA ROUTE DESTINATION L’AFRIQUE
J’AI TOUJOURS VOULU REVOIR CE GRAND FLEUVE DE RÊVE
OÙ LE COUCHER DU SOLEIL CHANGENT LES EAUX EN MIEL

MAIS L’HEURE N’EST PLUS AUX VOYAGES AU PASSAGES DE FRONTIÈRES
Y’A CHANGEMENT DE PAYSAGE SUR TOUTE L’ÉTENDUE DE LA TERRE
ET PLUS MOYEN DE REVOIR SAUF EN RÊVE
LES PAYS QU’ON A AIMÉS LES AMIS QU’ON A SEMÉS

ENFIN LA NUIT SUR PANAME RETOMBE EN DOUCEUR
EST-CE LA NUIT DE L’IGUANE OU CELLE DU CHASSEUR
ON SE CROISE SANS SE VOIR COMME EN RÊVE
PARFOIS UNE AILE NOUS FRÔLE UNE MAIN SUR L’ÉPAULE

ME REVOILÀ DANS LE NOIR ET BLANC DE MON LIT
PAS MAL ÉTONNÉ D’AVOIR RÊVÉ DE JOHNNY
PLUTÔT QUE DE TOI MON POTE MAIS LES RÊVES
N’EN FONT JAMAIS QU’À LEUR TÊTE LEUR MISSION EST SECRÈTE

ALORS AMIS DISPARUS Ô CHERS ABONNÉS ABSENTS
QUI DU PASSÉ AU FUTUR SEREZ TOUJOURS PRÉSENT
JE VOUS DONNE RENDEZ-VOUS DANS MES RÊVES
VOUS LAISSANT LE CHOIX DU LIEU, DE L’HEURE ET DE LA NUIT

TU ME VOIS TU ME REGARDES MAIS TU ME FLASHES PLUS
TOUT JUSTE SI TU PRÊTES GARDE À MON PARDESSUS
C’ÉTAIT COOL DE SE REVOIR M’A DIT JOHNNY EN RÊVE
AVANT D’ALLER SE FAIRE VOIR DANS LA NUIT DE SAINT-TROPEZ

AGING

AGING
CHANGING
THE PAGINATION
IMAGINATION
USING

MMM MMM
HUMMING
IN A SLOW MOTION
AND THROWING CAUTION TO THE WIND

HAVE YOU HEARD ABOUT THE BIRD FLYING BACKWARDS
SEEMS ABSURD SO IS THE WORLD FROM THE BEGINNING

AGING
GENTLY AGING
A TRAGIC POTION
THAT’S WHAT THEY MENTION IN
THE WIND

CLOCK UNWISE SUNSET SUNRISE GLIDING BACKWARDS
ALL I KNOW IS ALL I SAW SINCE THE BEGINNING

HAVE YOU HEARD ABOUT THE BIRD FLYING BACKWARDS
ALL I SAW IS ALL I KNOW FROM THE BEGINNING
YOUNGER GROWING
REBECOMING

AGING
DE-AGING

Ukraine : À chacun sa vérité…

Bruno Bertez – brunobertez.com

ministre ukrainien Nikolai Azarov

« C’est pour empêcher la Troisième Guerre mondiale et une attaque contre la Russie avec des armes nucléaires, que le gouvernement russe a décidé de neutraliser la menace et de rétablir l’ordre en Ukraine » – déclare l’ancien Premier ministre ukrainien Azarov.

Un ancien Premier ministre ukrainien, Nikolai Azarov, a publié un message sur Facebook affirmant que l’Organisation du Traité de l’Atlantique Nord (OTAN) prévoyait une attaque nucléaire contre la Russie.

En réponse à leur attaque potentielle, la Russie a décidé d’arrêter la situation et de rétablir l’ordre en Ukraine.

« L’OTAN voulait déclencher une troisième guerre mondiale en utilisant des armes nucléaires contre la Russie », a déclaré Azarov. « Depuis décembre 2021, la Russie reçoit des informations sur les projets de l’OTAN de déployer quatre brigades militaires (2 terrestres, une marine, une aérienne) sur le territoire de l’Ukraine ».

L’une de ces brigades pourrait transporter des ogives nucléaires.

Troisième Guerre mondiale

L’OTAN voulait déployer des troupes à l’été 2022. « Afin d’empêcher la Troisième Guerre mondiale et de prévenir une attaque contre la Russie avec armes nucléaires, le gouvernement russe a décidé d’arrêter cette situation et de rétablir l’ordre en Ukraine », écrit Azarov, qui a été premier ministre en 2004, 2005 et 2010.

Il déclare que l’armée ukrainienne prévoyait également de lancer une opération militaire dans le Donbass afin d’éliminer la population russophone. L’attaque était coordonnée avec les États-Unis et devait être lancée le 25 février 2022.

Le président russe Vladimir Poutine a sauvé des centaines de milliers de vies à Donetsk et Lougansk (connues collectivement sous le nom de région du Donbass) en ordonnant une opération militaire spéciale en Ukraine, a déclaré l’ancien Premier ministre.

Azarov a également fait remarquer qu’une semaine avant que la Russie ne lance son opération militaire en Ukraine, les forces de la République populaire de Donetsk (RPD) ont saisi une carte de l’armée ukrainienne, qui détaillait une attaque à grande échelle contre les républiques du Donbass.

Guerre cognitive – ou La Guerre pour les Esprits

Guerre cognitive – Résumé Comme écrit dans le Warfighting 2040 Paper, la nature de la guerre a changé. La majorité des conflits actuels restent en dessous du seuil de la définition traditionnellement acceptée de la guerre, mais de nouvelles formes de guerre sont apparues telles que la guerre cognitive (COGNITIVE WARFARE), tandis que l’esprit humain est désormais considéré comme un nouveau domaine de la guerre.

Avec le rôle croissant de la technologie et la surcharge d’informations, les capacités cognitives individuelles ne seront plus suffisantes pour assurer une prise de décision éclairée et opportune, conduisant au nouveau concept de guerre cognitive, qui est devenu un terme récurrent dans la terminologie militaire ces dernières années. Cognitive Warfare provoque un défi insidieux. Elle perturbe les compréhensions et les réactions ordinaires aux événements de manière progressive et subtile, mais avec des effets néfastes importants au fil du temps. La guerre cognitive a une portée universelle, de l’individu aux États et aux organisations multinationales. Elle se nourrit des techniques de désinformation et de propagande visant à épuiser psychologiquement les récepteurs de l’information.

Tout le monde y contribue, à des degrés divers, consciemment ou inconsciemment, et il fournit des connaissances inestimables sur la société, en particulier les sociétés ouvertes, comme celles de l’Occident. Ces connaissances peuvent ensuite être facilement militarisées. Il offre aux adversaires de l’OTAN un moyen de contourner le champ de bataille traditionnel avec des résultats stratégiques significatifs, qui peuvent être utilisés pour transformer radicalement les sociétés occidentales. Les instruments de la guerre de l’information, ainsi que l’ajout de «neuro-armes» ajoutent aux perspectives technologiques futures, suggérant que le champ cognitif sera l’un des champs de bataille de demain. Cette perspective est encore renforcée par les progrès rapides des NBIC (nanotechnologies, biotechnologies, technologies de l’information et sciences cognitives) et la compréhension du cerveau. Les adversaires de l’OTAN investissent déjà massivement dans ces nouveaux les technologies.

L’OTAN doit anticiper les progrès de ces technologies en faisant prendre conscience du véritable potentiel des armes chimiques. Quels que soient la nature et l’objet de la guerre, cela se résume toujours à un affrontement de volontés humaines, et donc ce qui définit la victoire sera la capacité d’imposer un comportement souhaité à un public choisi. Les actions entreprises dans les cinq domaines – air, terre, mer, espace et cyber – sont toutes exécutées dans le but d’avoir un effet sur le domaine humain. Il est donc temps pour l’OTAN de reconnaître l’importance renouvelée du sixième domaine opérationnel, à savoir le domaine humain.

TÉLÉCHARGEZ LE DOCUMENT EN PDF/ VERSION EN ANGLAIS SUR LE LIEN CI-DESSOUS:

htps://guimond.files.wordpress.com/2022/03/20210122_cw-final.pdf

L’organisatrice et porte-parole du « Convoi de la Liberté » Tamara Lich est libérée sous caution par la Cour supérieure de justice de l’Ontario

par Guy Boulianne – URL/ SOURCE: https://guyboulianne.com/2022/03/08/lorganisatrice-et-porte-parole-du-convoi-de-la-liberte-tamara-lich-est-liberee-sous-caution-par-la-cour-superieure-de-justice-de-lontario/

Tamara Lich, l’une des principales organisatrices et porte-parole du « Convoi de la Liberté » qui a lancé une manifestation de trois semaines à Ottawa pour s’opposer aux mandats fédéraux de la COVID-19, a été libérée sous caution par un tribunal ontarien. Lich s’était déjà vu refuser la mise en liberté sous caution le 22 février par la juge de la Cour de l’Ontario Julie Bourgeois, qui avait déclaré que sa détention était « nécessaire à la protection et à la sécurité du public ». L’avocat de Lich a lancé une révision de la caution, arguant que la décision pourrait avoir été entachée par le fait que Bourgeois s’est présentée comme candidate libérale fédéral aux élections de 2011. Le 7 mars, le juge de la Cour supérieure de l’Ontario, l’honorable John M. Johnston a accordé une caution à Lich sur une caution de 25 000 $.

Dans sa décision, Johnston a déclaré qu’il avait trouvé que les arguments sur le passé politique de Bourgeois n’avaient aucun fondement, mais a noté qu’il avait trouvé plusieurs autres erreurs de droit dans la décision du juge. Il a dit que Bourgeois était trop subjective lorsqu’elle évaluait la gravité des infractions, les mettant en balance avec les impacts sur les résidents d’Ottawa plutôt que de les comparer objectivement à d’autres infractions au Code criminel.

Johnston a également déclaré que si Bourgeois avait déterminé que Lich pouvait purger une longue peine de prison pouvant aller jusqu’à 10 ans, il trouvait lui-même très peu probable qu’elle purgerait plus de deux ans si elle était reconnue coupable.

Johnston a déclaré que le risque de libérer Lich peut être traité par une nouvelle caution proposée par son avocat. La nouvelle caution — un membre de la famille dont l’identité est protégée par une interdiction de publication ordonnée par le tribunal — a été condamnée à déposer une caution de 20 000 $. Lich doit également déposer une caution de 5 000 $.

Lich doit respecter plusieurs conditions, notamment ne pas avoir de contact avec les autres organisateurs du convoi. Elle a reçu l’ordre de quitter Ottawa dans les 24 heures et la province de l’Ontario dans les 72 heures.

Après l’arrestation de Lich le 17 février, ses partisans ont déclaré qu’elle était une prisonnière politique, et certains se sont rassemblés au cours du week-end devant la prison d’Ottawa où elle était détenue pour exiger sa libération.

Cet appel a atteint le Royaume-Uni, où le Premier ministre Justin Trudeau, qui a rencontré lundi le Premier ministre britannique Boris Johnson à Londres, a été accueilli devant le 10 Downing Street par des manifestants tenant des pancartes exigeant la libération de Lich.

À la suite de l’annonce de la mise en liberté sous caution par le tribunal de l’Ontario lundi, les partisans de Lich se sont rassemblés devant le palais de justice du centre-ville d’Ottawa et ont chanté « Ô Canada » en signe de célébration.

Drew Barnes, député provincial de Cypress-Medicine Hat, a publié une déclaration sur Twitter le 7 mars disant que Lich, son électeur, avait été libéré sous caution « dans des conditions strictes », et la décision a annulé la décision précédente de refuser sa libération sous caution, ce qu’il a dit « soulevé de sérieuses inquiétudes concernant la partialité judiciaire ».

« Les faits dans cette affaire sont clairs : Tamara Lich n’est pas une criminelle violente et elle n’a pas été accusée d’un crime violent. Malgré cela, la semaine dernière, elle a été perpétrée devant le tribunal avec des chaînes, dans une tentative claire de la dépeindre comme une menace pour la société », a-t-il écrit. « Cette affaire souligne le danger inhérent que l’activisme judiciaire représente pour les droits et libertés individuels de tous les citoyens canadiens. »

LIRE LA SUITE: https://guyboulianne.com/2022/03/08/lorganisatrice-et-porte-parole-du-convoi-de-la-liberte-tamara-lich-est-liberee-sous-caution-par-la-cour-superieure-de-justice-de-lontario/

Le programme d’armes biologiques du Pentagone n’a jamais pris fin — Les laboratoires biologiques américains dans le monde… y compris en Ukraine.

Dilyana Gaytandzhieva — Dylana.bg – URL/ SOURCE: Sott.net – ven., 04 mar. 2022

CHERS LECTEURS; je vous conseille de suivre le lien sur Sott.net ici-haut pour accéder toutes les images qui valent le détour. – Daniel Guimond

Commentaire : À la lumière de la guerre de libération/dénazification et démilitarisation menée par la Russie en Ukraine, le monumental article qui suit, bien que datant de 2018 et relatif à l’infrastructure mondiale massive de laboratoires d’armes biologiques que les États-Unis maintiennent dans le monde — mais aussi en Ukraine et en Géorgie — laisse à penser que la démilitarisation de l’Ukraine par la Russie ne concernerait pas uniquement les armes dites conventionnels, mais également les armes biologiques (même si ces dernières font certainement l’objet d’attentions particulières, au vue de leurs natures).

Nous avions publié en 2017 un article qui évoquait, au conditionnel, les laboratoires militaires américains en Ukraine :
Les États-Unis seraient en train de transformer l’Ukraine en « bombe biologique », nous avons aujourd’hui un certain nombre de réponses
et un autre en 2018 qui présentait celui que nous publions aujourd’hui :
Enquête journalistique: les États-Unis développent des armes biologiques dans les laboratoires à travers le monde

En ce qui concerne l’accusation de la Chine qui pointe du doigt depuis le début de la « crise Covid-19 » un certain laboratoire biologique installé de longue date dans le Maryland aux États-Unis, Fort Detrick pour le nommer, comme étant une source possible du Sras-CoV-2/Covid-19, voir notre article :
Les preuves irréfutables de l’origine humaine du Sras-Cov-2

Pentagon bio-weapons

L’armée américaine produit régulièrement des virus, bactéries et toxines mortels en violation directe de la Convention des Nations Unies sur l’interdiction des armes biologiques. Des centaines de milliers de personnes involontaires sont systématiquement exposées à des agents pathogènes dangereux et à d’autres maladies incurables. Des scientifiques de la guerre biologique utilisant la couverture diplomatique testent des virus artificiels dans les laboratoires biologiques du Pentagone dans 25 pays à travers le monde. Ces laboratoires bilogoqies américains sont financés par la Defense Threat Reduction Agency (DTRA [« Agence de réduction des menaces de la Défense »]) dans le cadre d’un programme militaire de 2,1 milliards de dollars — Cooperative Biological Engagement Program (CBEP [« Programme coopératif d’engagement biologique »]) — et sont situés dans des pays de l’ex-Union soviétique tels que la Géorgie et l’Ukraine, au Moyen-Orient, en Asie du Sud-Est et en Afrique.

La Géorgie est un terrain d’essai pour les armes biologiques

Le Lugar Center est le laboratoire biologique du Pentagone en Géorgie. Il est situé à seulement 17 km de la base aérienne militaire américaine de Vaziani dans la capitale Tbilissi. Le programme militaire est confié à des biologistes de l’unité de recherche médicale de l’armée américaine en Géorgie (USAMRU-G) ainsi qu’à des entrepreneurs privés. Le laboratoire de biosécurité de niveau 3 est accessible uniquement aux citoyens américains disposant d’une habilitation de sécurité. Ils bénéficient de l’immunité diplomatique en vertu de l’accord de 2002 entre les États-Unis et la Géorgie sur la coopération en matière de défense.

L’armée américaine a été déployée sur la base aérienne militaire de Vaziani, à 17 km du laboratoire biologique du Pentagone au Lugar Center. Le Lugar Center est le laboratoire biologique du Pentagone en Géorgie. Il est situé à seulement 17 km de la base aérienne militaire américaine de Vaziani, dans la capitale Tbilissi. Les biologistes de l’US Army Medical Research Unit-Georgia (USAMRU-G) et des contractants privés sont chargés du programme militaire. Le laboratoire de niveau de biosécurité 3 n’est accessible qu’aux citoyens américains ayant une autorisation de sécurité. Ils bénéficient de l’immunité diplomatique en vertu de l’accord de coopération en matière de défense conclu entre les États-Unis et la Géorgie en 2002.

DOD requirements
Accord USA-Géorgie

L’accord USA-Géorgie accorde un statut diplomatique au personnel militaire et civil américain (y compris les véhicules diplomatiques), travaillant sur le programme du Pentagone en Géorgie.

Les informations obtenues du registre fédéral américain des contrats clarifient certaines des activités militaires du Lugar Center — parmi lesquelles la recherche sur les bio-agents (anthrax, tularémie) et les maladies virales (par exemple la fièvre hémorragique de Crimée-Congo) et la collecte d’échantillons biologiques pour futures expérimentations.

Lire la suite de « Le programme d’armes biologiques du Pentagone n’a jamais pris fin — Les laboratoires biologiques américains dans le monde… y compris en Ukraine. »

Les Britanniques commencent à soupçonner quelque chose

Par Andrei Martyanov − Le 3 mars 2022 − Source Reminiscence of the future

guerre britannique

La réalité commence à s’insinuer. Regardez ce gros titre d’aujourd’hui.

Poutine n’est PAS fou et l’invasion russe n’est PAS un échec. Les illusions de l’Occident sur cette guerre – et son incapacité à comprendre l’ennemi – l’empêcheront de sauver l’Ukraine, écrit l’analyste militaire. – Bill Roggio

Roggio s’en plaint même :

Le monde a déjà sous-estimé Poutine par le passé et ces erreurs ont conduit, en partie, à cette tragédie en Ukraine. Nous devons être lucides maintenant que la guerre est en cours. Pourtant, même les professionnels du Pentagone laissent la sympathie obscurcir leur jugement. Deux jours à peine après l’invasion de l’Ukraine par la Russie, les responsables du département de la défense des États-Unis ont rapidement déclaré que le fait de ne pas avoir pris Kiev dans les premiers jours de la guerre constituait un sérieux revers. Ils ont laissé entendre que l’offensive russe avait pris beaucoup de retard ou avait même échoué parce que la capitale n’était pas tombée. Mais les dirigeants américains auraient dû apprendre à modérer leurs espoirs après leur retrait catastrophique d’Afghanistan.

Roggio devrait apprendre que les dirigeants américains n’apprennent pas et que si les professionnels de l’armée ont « la sympathie qui obscurcit leur jugement » – ils ne sont pas des professionnels. Pour Roggio, je peux affirmer sans ambages que le Pentagone et les services de renseignements américains ont une vague compréhension de la Russie, de l’armée russe et de la manière dont elle est intégrée dans la société russe.

Les États-Unis n’ont tout simplement pas cette expérience historique, culturelle, doctrinale et stratégique. Lisez sur mes lèvres (encore une fois) : Aucun militaire américain, du général au simple soldat, n’a jamais combattu dans l’histoire moderne pour défendre sa patrie. Point final. Les expériences de combat américaines sont très limitées et les résultats militaires sont plutôt décevants. Parler de tactique et de jargon opérationnel ne répond pas à la question de la guerre continentale. Ce n’est pas surprenant pour un pays où Patton est considéré comme un
« génie de la guerre » et où le livre d’Earl Ziemke, qui prouve que les Alliés occidentaux ont gagné la Seconde Guerre mondiale principalement sur les théâtres secondaires, peut encore être téléchargé depuis l’US Army War College. Il est tout à fait naturel de voir son propre jugement obscurci. En fait, ce n’est pas un défaut, mais une caractéristique.

Mais Patrick Armstrong va plus loin et donne une perspective plus large (sans oublier d’aborder les questions opérationnelles et stratégiques) et je cite :

Nous assistons à l’effondrement du triomphalisme post-guerre froide, de la « fin de l’histoire », de l’« unilatéralisme » et de tout le reste. La réalité mord, et elle mord fort. Il suffit de regarder le défilé des têtes parlantes et des « experts » de CNN qui spéculent sur la folie de Poutine : ils ne comprennent pas, il doit donc être fou. Pour l’Occident, comme cela a été le cas, c’est fini. La confusion, les conneries, la vantardise, l’hystérie, les interdictions : l’Occident n’a plus rien dans son casier.

Verser de la vodka russe dans les toilettes, virer un chanteur et un réalisateur, changer le nom d’une boisson ou d’une salade, interdire les chats ou les arbres, sanctionner un ploutocrate russe et voler son yacht, porter un t-shirt bleu et jaune. C’est pathétique. Et ne laissez en aucun cas un média russe tenter les moutons avec de la « désinformation ». Tout comme l’URSS, mais en plus stupide. Et qui aurait cru qu’il était possible d’être plus stupide ?

Et si Roggio a de la sympathie pour l’Ukraine actuelle, il ferait mieux d’apprendre l’histoire de la Russie, non pas qu’il soit capable de la saisir – des personnes bien plus compétentes que lui n’y sont pas parvenues. Mais au moins, il commence à sentir où les vents soufflent. Et oui, ce qui manque dans l’article de Roggio – les comparaisons entre les guerres russes et américaines seront à nouveau faites et nous savons tous comment elles seront jugées.

L’Amérique bat l’Allemagne pour la troisième fois en un siècle

URL/ SOURCE/ ANGLAIS – Michael Hudson – https://michael-hudson.com/2022/02/america-defeats-germany-for-the-third-time-in-a-century/

« Les dirigeants nationalistes européens (la gauche est largement pro-américaine) se demanderont-ils pourquoi leurs pays devraient payer pour des armes américaines qui ne font que les mettre en danger, payer des prix plus élevés pour le GNL et l’énergie américains, payer plus pour les céréales et les matières premières produites en Russie, tout cela tout en perdant la possibilité de réaliser des ventes à l’exportation et des bénéfices sur des investissements pacifiques en Russie – et peut-être aussi en perdant la Chine ?

La confiscation par les États-Unis des réserves monétaires russes, à la suite du récent vol des réserves afghanes (et de la saisie par l’Angleterre des stocks d’or vénézuéliens qui y sont détenus) menace l’adhésion de chaque pays au dollar standard, et donc le rôle du dollar en tant que véhicule d’épargne en devises par le banques centrales du monde. Cela accélérera le processus international de dédollarisation déjà entamé par la Russie et la Chine, qui s’appuient sur des avoirs mutuels dans les devises de l’autre. »